Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1929428
End position: 1929451
Length: 24

DNA sequence
>NC_009142, from 1929428 to 1929451 (24 bp); Saccharopolyspora erythraea NRRL 2338 GGCCGCCGCCGCGGCCGAGACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1928644-1929576	Sequence	SACE_1752 miaA tRNA delta(2)-isopentenylpyrophosphate transferase