Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 2359138
End position: 2359161
Length: 24

DNA sequence
>NC_009142, from 2359138 to 2359161 (24 bp); Saccharopolyspora erythraea NRRL 2338 GCGCCAGCGCCAGCGGCAGCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2357952-2359538	Sequence	SACE_2172 - hypothetical protein (Protein is coded in complementary strand; from 2359538 to 2357952)