Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 2361769
End position: 2361792
Length: 24

DNA sequence
>NC_009142, from 2361769 to 2361792 (24 bp); Saccharopolyspora erythraea NRRL 2338 ACGTCGACGTCCGCGTCGACGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2360533-2361996	Sequence	SACE_2174 sufB iron-regulated ABC-type transporter