Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 2868291
End position: 2868314
Length: 24

DNA sequence
>NC_009142, from 2868291 to 2868314 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGGTGCGGAGGTGCGGCGGTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2862520-2876250	Sequence	SACE_2630 - modular polyketide synthase (Protein is coded in complementary strand; from 2876250 to 2862520)