Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 298005
End position: 298028
Length: 24

DNA sequence
>NC_009142, from 298005 to 298028 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGGTCCCGGTGCCGGACCCGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 297225-298331	Sequence	SACE_0261 - oligopeptide ABC transporter ATP-binding protein