Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3087695
End position: 3087718
Length: 24

DNA sequence
>NC_009142, from 3087695 to 3087718 (24 bp); Saccharopolyspora erythraea NRRL 2338 GATGCCGGTGCCGATGGCGGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3086988-3088403	Sequence	SACE_2829 aspA aspartate ammonia-lyase (Protein is coded in complementary strand; from 3088403 to 3086988)