Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3091103
End position: 3091126
Length: 24

DNA sequence
>NC_009142, from 3091103 to 3091126 (24 bp); Saccharopolyspora erythraea NRRL 2338 GCACGGGCACGCGCACCGCCACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3091075-3092460	Sequence	SACE_2832 - two-component system sensor kinase (Protein is coded in complementary strand; from 3092460 to 3091075)