Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3117694
End position: 3117717
Length: 24

DNA sequence
>NC_009142, from 3117694 to 3117717 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGCGACCGCGGCCGCGAACGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3117434-3118345	Sequence	SACE_2857 - hypothetical protein (Protein is coded in complementary strand; from 3118345 to 3117434)