Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3166383
End position: 3166406
Length: 24

DNA sequence
>NC_009142, from 3166383 to 3166406 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGGCGACGGCGCTGGCGACGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3165575-3168268	Sequence	SACE_2890 nysRI LuxR family transcriptional regulator (Protein is coded in complementary strand; from 3168268 to 3165575)