Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3243592
End position: 3243615
Length: 24

DNA sequence
>NC_009142, from 3243592 to 3243615 (24 bp); Saccharopolyspora erythraea NRRL 2338 GGGTCGGCGTCGGCGTCGAGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3243244-3244404	Sequence	SACE_2961 - fructosyl-amino acid oxidase (Protein is coded in complementary strand; from 3244404 to 3243244)