Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3353705
End position: 3353728
Length: 24

DNA sequence
>NC_009142, from 3353705 to 3353728 (24 bp); Saccharopolyspora erythraea NRRL 2338 GCGCTGCCGCTGGCGTTGCCGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3352662-3353954	Sequence	SACE_3042 matC dicarboxylate carrier protein