Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3381036
End position: 3381059
Length: 24

DNA sequence
>NC_009142, from 3381036 to 3381059 (24 bp); Saccharopolyspora erythraea NRRL 2338 CCACGGCGACGGGCACGGCCACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3380972-3381868	Sequence	SACE_3076 - hydrogenase nickel incorporation protein HypB