Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3384043
End position: 3384066
Length: 24

DNA sequence
>NC_009142, from 3384043 to 3384066 (24 bp); Saccharopolyspora erythraea NRRL 2338 GGACCCTGACCCGCACCCGGACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3381819-3384059	Sequence	SACE_3077 hypF1 [NiFe] hydrogenase maturation protein HypF (Protein is coded in complementary strand; from 3384059 to 3381819)