Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3402209
End position: 3402232
Length: 24

DNA sequence
>NC_009142, from 3402209 to 3402232 (24 bp); Saccharopolyspora erythraea NRRL 2338 TCGCCGCCGCCGCCGCCGACGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3401345-3402337	Sequence	SACE_3092 xdhB xanthine dehydrogenase FAD-binding subunit