Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3494778
End position: 3494801
Length: 24

DNA sequence
>NC_009142, from 3494778 to 3494801 (24 bp); Saccharopolyspora erythraea NRRL 2338 CTGCACCGGCACCTGCTCCTGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3494050-3496095	Sequence	SACE_3165 - hydrolase (Protein is coded in complementary strand; from 3496095 to 3494050)