Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3518467
End position: 3518490
Length: 24

DNA sequence
>NC_009142, from 3518467 to 3518490 (24 bp); Saccharopolyspora erythraea NRRL 2338 TCGGCGACGGCGTCGGCTTCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3517330-3518823	Sequence	SACE_3185 wzz cell surface polysaccharide biosynthesis / chain length determinant protein