Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3880276
End position: 3880299
Length: 24

DNA sequence
>NC_009142, from 3880276 to 3880299 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGCCGCCGCTGCCGCCGCCGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3880223-3880708	Sequence	SACE_3520 - hypothetical protein (Protein is coded in complementary strand; from 3880708 to 3880223)