Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4011153
End position: 4011176
Length: 24

DNA sequence
>NC_009142, from 4011153 to 4011176 (24 bp); Saccharopolyspora erythraea NRRL 2338 GCGGCGAGGCGGGGAGGCGGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4011176-4012108	Sequence	SACE_3653 - integral membrane protein TerC