Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4129696
End position: 4129719
Length: 24

DNA sequence
>NC_009142, from 4129696 to 4129719 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGACCGCCACCGCCACCGCGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4129344-4130423	Sequence	SACE_3774 - hypothetical protein (Protein is coded in complementary strand; from 4130423 to 4129344)