Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4161983
End position: 4162006
Length: 24

DNA sequence
>NC_009142, from 4161983 to 4162006 (24 bp); Saccharopolyspora erythraea NRRL 2338 GCCTCGGCCGCGGCCACGTCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4160414-4162924	Sequence	SACE_3802 nirB nitrite reductase (NAD(P)H) large subunit