Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4339657
End position: 4339680
Length: 24

DNA sequence
>NC_009142, from 4339657 to 4339680 (24 bp); Saccharopolyspora erythraea NRRL 2338 CCGCCGCCACCGTCGCCGCCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4338897-4339667	Sequence	SACE_3956 - nucleotidyltransferase (Protein is coded in complementary strand; from 4339667 to 4338897)