Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4355082
End position: 4355105
Length: 24

DNA sequence
>NC_009142, from 4355082 to 4355105 (24 bp); Saccharopolyspora erythraea NRRL 2338 CAGGTCCGGGTCCACGTCCAGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4354933-4355955	Sequence	SACE_3970 - cation efflux system protein (Protein is coded in complementary strand; from 4355955 to 4354933)