Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4500459
End position: 4500482
Length: 24

DNA sequence
>NC_009142, from 4500459 to 4500482 (24 bp); Saccharopolyspora erythraea NRRL 2338 GGCGTCGGCGACGCCGTCGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4499848-4500498	Sequence	SACE_4089 - response regulator, two-component system (Protein is coded in complementary strand; from 4500498 to 4499848)