Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4501548
End position: 4501571
Length: 24

DNA sequence
>NC_009142, from 4501548 to 4501571 (24 bp); Saccharopolyspora erythraea NRRL 2338 TCAGCGTCACCGACAGCGTCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4500518-4501855	Sequence	SACE_4090 - alpha-ketoglutarate transporter (Protein is coded in complementary strand; from 4501855 to 4500518)