Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4519496
End position: 4519519
Length: 24

DNA sequence
>NC_009142, from 4519496 to 4519519 (24 bp); Saccharopolyspora erythraea NRRL 2338 GGCCGGGGCCGTGGGCGGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4518707-4520698	Sequence	SACE_4104 - short chain dehydrogenase (Protein is coded in complementary strand; from 4520698 to 4518707)