Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4537817
End position: 4537840
Length: 24

DNA sequence
>NC_009142, from 4537817 to 4537840 (24 bp); Saccharopolyspora erythraea NRRL 2338 ACGACGACGACATCGACGACGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4536542-4537846	Sequence	SACE_4116 aofH flavin-containing monoamine oxidase (Protein is coded in complementary strand; from 4537846 to 4536542)