Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 460953
End position: 460976
Length: 24

DNA sequence
>NC_009142, from 460953 to 460976 (24 bp); Saccharopolyspora erythraea NRRL 2338 TCGCGCTCGGGCTCGCGGGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 460677-461747	Sequence	SACE_0411 fepD ferrichrome transport system permease