Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4777641
End position: 4777664
Length: 24

DNA sequence
>NC_009142, from 4777641 to 4777664 (24 bp); Saccharopolyspora erythraea NRRL 2338 GCGGCAGCGTCAGCAGCACCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4772801-4782814	Sequence	SACE_4287 - non-ribosomal peptide synthetase (Protein is coded in complementary strand; from 4782814 to 4772801)