Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4938093
End position: 4938116
Length: 24

DNA sequence
>NC_009142, from 4938093 to 4938116 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGGCGAGGGCGACGGCGACGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4937948-4939150	Sequence	SACE_4408 - multidrug ABC transporter permease (Protein is coded in complementary strand; from 4939150 to 4937948)