Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 503794
End position: 503817
Length: 24

DNA sequence
>NC_009142, from 503794 to 503817 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGCCGACGCCGACACCGACACCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 503157-504035	Sequence	SACE_0451 - ABC-type transporter, permease component (Protein is coded in complementary strand; from 504035 to 503157)