Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 5053060
End position: 5053083
Length: 24

DNA sequence
>NC_009142, from 5053060 to 5053083 (24 bp); Saccharopolyspora erythraea NRRL 2338 AGCGCCAGCTCCCGCGCCTGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5052679-5053701	Sequence	SACE_4519 - GroES-like alcohol dehydrogenase (Protein is coded in complementary strand; from 5053701 to 5052679)