Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 505460
End position: 505483
Length: 24

DNA sequence
>NC_009142, from 505460 to 505483 (24 bp); Saccharopolyspora erythraea NRRL 2338 GTGGTCGTGGCCGTGCTCGTGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 504930-506087	Sequence	SACE_0453 - ABC-type transporter (Protein is coded in complementary strand; from 506087 to 504930)