Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 5099269
End position: 5099292
Length: 24

DNA sequence
>NC_009142, from 5099269 to 5099292 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGCGTGCGCGAGCGCGAGCGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5098859-5100235	Sequence	SACE_4561 - FAD dependent oxidoreductase (Protein is coded in complementary strand; from 5100235 to 5098859)