Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 5454613
End position: 5454636
Length: 24

DNA sequence
>NC_009142, from 5454613 to 5454636 (24 bp); Saccharopolyspora erythraea NRRL 2338 TCGGCCTCGCCCTCGTCCCCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5454565-5455593	Sequence	SACE_4882 - ABC transporter permease (Protein is coded in complementary strand; from 5455593 to 5454565)