Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 5615443
End position: 5615466
Length: 24

DNA sequence
>NC_009142, from 5615443 to 5615466 (24 bp); Saccharopolyspora erythraea NRRL 2338 CTCGGCATCGGCCTCGACCTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5615081-5616202	Sequence	SACE_5034 - hypothetical protein (Protein is coded in complementary strand; from 5616202 to 5615081)