Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 5772337
End position: 5772360
Length: 24

DNA sequence
>NC_009142, from 5772337 to 5772360 (24 bp); Saccharopolyspora erythraea NRRL 2338 GTCATCGTCGTCGTCCTCGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 5771902-5772342	Sequence	SACE_5161 - hypothetical protein (Protein is coded in complementary strand; from 5772342 to 5771902)