Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 5858440
End position: 5858463
Length: 24

DNA sequence
>NC_009142, from 5858440 to 5858463 (24 bp); Saccharopolyspora erythraea NRRL 2338 CCGCCTCCGCGTCGGCCTGCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5858406-5859266	Sequence	SACE_5239 scpA segregation and condensation protein A (Protein is coded in complementary strand; from 5859266 to 5858406)