Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 5965574
End position: 5965597
Length: 24

DNA sequence
>NC_009142, from 5965574 to 5965597 (24 bp); Saccharopolyspora erythraea NRRL 2338 CCGGTCGCGGTCACGGTCGCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5965230-5965793	Sequence	SACE_5331 - hypothetical protein (Protein is coded in complementary strand; from 5965793 to 5965230)