Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 5990638
End position: 5990661
Length: 24

DNA sequence
>NC_009142, from 5990638 to 5990661 (24 bp); Saccharopolyspora erythraea NRRL 2338 GCGTCGGCGTCGACGTCGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5989999-5990766	Sequence	SACE_5352 - short chain dehydrogenase (Protein is coded in complementary strand; from 5990766 to 5989999)