Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6029331
End position: 6029354
Length: 24

DNA sequence
>NC_009142, from 6029331 to 6029354 (24 bp); Saccharopolyspora erythraea NRRL 2338 GCGAGGCCGAGGGCGAGGGCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6028634-6029392	Sequence	SACE_5387 - branched-chain amino acid permease (Protein is coded in complementary strand; from 6029392 to 6028634)
ORF. 6029307-6029912	Sequence	SACE_5388 lrp leucine responsive regulator