Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6114596
End position: 6114619
Length: 24

DNA sequence
>NC_009142, from 6114596 to 6114619 (24 bp); Saccharopolyspora erythraea NRRL 2338 TCGGCGTCGTCGTCGGCCTCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6114029-6115021	Sequence	SACE_5460 - hypothetical protein (Protein is coded in complementary strand; from 6115021 to 6114029)