Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6170808
End position: 6170831
Length: 24

DNA sequence
>NC_009142, from 6170808 to 6170831 (24 bp); Saccharopolyspora erythraea NRRL 2338 GACGGCGATGGCGACGTCGACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6150160-6185538	Sequence	SACE_5483 - hypothetical protein (Protein is coded in complementary strand; from 6185538 to 6150160)