Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 626615
End position: 626638
Length: 24

DNA sequence
>NC_009142, from 626615 to 626638 (24 bp); Saccharopolyspora erythraea NRRL 2338 GGGTCTGGGTCTTGGTCTCGGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 626428-627033	Sequence	SACE_0567 - hypothetical protein (Protein is coded in complementary strand; from 627033 to 626428)