Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6271508
End position: 6271531
Length: 24

DNA sequence
>NC_009142, from 6271508 to 6271531 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGGCGTCGACGTCGGCGCCGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6271366-6272895	Sequence	SACE_5574 - HAD family hydrolase (Protein is coded in complementary strand; from 6272895 to 6271366)