Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6525571
End position: 6525594
Length: 24

DNA sequence
>NC_009142, from 6525571 to 6525594 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGCCTGGGCCTGCGCCTCCGGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6524921-6526138	Sequence	SACE_5814 cypA cytochrome P450-like enzyme (Protein is coded in complementary strand; from 6526138 to 6524921)