Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6683916
End position: 6683939
Length: 24

DNA sequence
>NC_009142, from 6683916 to 6683939 (24 bp); Saccharopolyspora erythraea NRRL 2338 CTCGACCACGACCTCGGCCTGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6682042-6685647	Sequence	SACE_5955 cobN cobaltochelatase subunit CobN