Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6792025
End position: 6792048
Length: 24

DNA sequence
>NC_009142, from 6792025 to 6792048 (24 bp); Saccharopolyspora erythraea NRRL 2338 GCCGCCGCTGCCGCCGCTGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6791939-6793495	Sequence	SACE_6057 ffh signal recognition particle GTPase (Protein is coded in complementary strand; from 6793495 to 6791939)