Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6794090
End position: 6794113
Length: 24

DNA sequence
>NC_009142, from 6794090 to 6794113 (24 bp); Saccharopolyspora erythraea NRRL 2338 GGGCTCGGGCTCGGGTTCGCGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6793677-6795413	Sequence	SACE_6058 deaD ATP-dependent RNA helicase (Protein is coded in complementary strand; from 6795413 to 6793677)