Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6853238
End position: 6853261
Length: 24

DNA sequence
>NC_009142, from 6853238 to 6853261 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGGTGTCGGCGTCGGGGTCGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6853177-6853806	Sequence	SACE_6110 - TetR/AcrR family transcriptional regulator (Protein is coded in complementary strand; from 6853806 to 6853177)