Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7053251
End position: 7053274
Length: 24

DNA sequence
>NC_009142, from 7053251 to 7053274 (24 bp); Saccharopolyspora erythraea NRRL 2338 GACGTCGAAGTCGACGCCGAAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7052343-7054004	Sequence	SACE_6300 argS arginyl-tRNA synthetase (Protein is coded in complementary strand; from 7054004 to 7052343)